rs4810312 chr20:41340067 C>G
- Sequence
ttgcccaaggcacgagagtaaatg[C/G]accttccgcgtgcctcggcgcacc
- ASB in cell types
- K562 (myelogenous leukemia) foreskin keratinocyte T-ALL cells from peripheral blood right lobe of liver
- ASB for transcription factors
- MBL2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MBL2_HUMAN | 1.42 | -0.16 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, body mass index (bmi), hdl cholesterol change with statins, infant head circumference, ldl cholesterol, total cholesterol, waist hip ratio
GTEx eQTL Artery_Aorta, Artery_Tibial, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Liver, Lung, Pancreas, Pituitary, Stomach, Thyroid