rs4810485 chr20:46119308 T>G
- Sequence
ctactttagagggctgtagattcc[T/G]gcctgaagcctgggcaggaatgac
- ASB for transcription factors
- CBP_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CBP_HUMAN | 2.45 | -0.65 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI multiple sclerosis, rheumatoid arthritis, rheumatoid arthritis (acpa-positive), systemic lupus erythematosus
GRASP advanced age-related macular degeneration (geographic atrophy), bipolar disorder, comorbid depressive syndrome and alcohol dependence, infant head circumference, irritible bowel syndrome, kawasaki disease, major depressive disorder, multiple sclerosis, response to tocilizumab for the treatment of rheumatoid arthritis (change in health assessment questionnaire score), rheumatoid arthritis, rheumatoid arthritis, cyclic citrullinated peptide (ccp) positive, selective immunoglobulin a deficiency (igad), total cholesterol
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Amygdala, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Kidney_Cortex, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Vagina, Whole_Blood