rs4810642 chr20:47464955 C>T
- Sequence
tctgagagcagggatcatgtgcta[C/T]acattttcttaatcttcgataatg
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.93 | 0.01 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, fasting blood glucose, ldl cholesterol, ldl cholesterol change with statins, major depressive disorder (broad definition), major depressive disorder (broad definition) (females), total cholesterol, total cholesterol change with statins