rs4810671 chr20:47726848 A>G
- Sequence
gtgtgcctgtctgtcaccacagtc[A/G]cccttccctcacttttgaccctgc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.16 | 1.44 | 5.70 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.39 | 1.60 | 1.62 |
Items per page:
1 – 2 of 2