rs4810820 chr20:48572946 C>T
- Sequence
cactcaagacagtggttttatccc[C/T]ggtaaaaataagacaccattccgg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.87 | 0.19 | 5.92 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, longstanding arthritis, mitral annular calcium, schizophrenia, total cholesterol, urinary albumin-to-creatinine ratio, variant creutzfeldt-jakob disease, venous thrombosis