rs4811711 chr20:56520986 T>G
- Sequence
caaagtccagggcaaaattagaat[T/G]gctgatgaggtttcatgtcccact
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- TYY1_HUMAN TIF1B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TYY1_HUMAN | -2.18 | 1.56 | 1.50 | 4.96 | Concordant | |||
| TIF1B_HUMAN | 1.03 | -0.57 | 1.20 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Artery_Aorta, Esophagus_Mucosa, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood