rs4970379 chr1:940390 A>G
- Sequence
gggcgctgggccccgctgggatcg[A/G]tgcgggcggccgcgccggctgggc
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) HCT-116 (colon carcinoma) iPS-derived dermal fibroblasts
- ASB for transcription factors
- MEIS2_HUMAN ZN692_HUMAN RARA_HUMAN ZN282_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MEIS2_HUMAN | n/a | 2.62 | 1.50 | n/a | No Hit | |||
| ZN692_HUMAN | 1.51 | n/a | 2.00 | n/a | No Hit | |||
| RARA_HUMAN | 0.90 | 1.44 | 1.00 | n/a | No Hit | |||
| ZN282_HUMAN | -0.06 | 2.13 | 1.50 | 3.18 | Concordant |
Items per page:
1 – 4 of 4
Motif analysis
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Liver, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood