rs5158 chr19:44943921 C>T
- Sequence
acacagctagctacatgtggcccc[C/T]gcgtgacggctggtctctgtaggc
- ASB in cell types
- GM01310 ( Transformed lymphovlasoid cell line ) HL-60 (acute myeloid leukemia) MDM(monocyte derived macrophages)
- ASB for transcription factors
- AHR_HUMAN SPI1_HUMAN INT13_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| AHR_HUMAN | -3.18 | 2.08 | 1.50 | 2.61 | Concordant | |||
| SPI1_HUMAN | 1.76 | n/a | 2.50 | n/a | No Hit | |||
| INT13_HUMAN | 2.01 | -2.10 | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP fasting insulin, homa-b, homa-ir, late onset alzheimers disease, ldl cholesterol, microalbuminuria, rheumatoid arthritis, total cholesterol, triglycerides
GTEx eQTL Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Lung, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis