rs52897 chr14:78934295 G>T
- Sequence
ttctttaaaggccatgaggtattt[G/T]taaacacgagagctttccaaactt
- ASB in cell types
- GM19238 (female B-cells lymphoblastoid cell lines) PC9 (lung adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19238 (female B-cells lymphoblastoid cell lines) | -4.13 | 2.73 | 1.33 | |||
| PC9 (lung adenocarcinoma) | -0.48 | 1.14 | 1.00 |
Items per page:
1 – 2 of 2