rs535202320 chr1:161460065 A>C
- Sequence
tgctaaggaggggaggggaaaaaa[A/C]gtcccacagcgaatcttggcgctg
- ASB in cell types
- DKO-1 (Colon adenocarcinoma)
- ASB for transcription factors
- MECP2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MECP2_HUMAN | 2.44 | -1.43 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1