rs539771 chr1:160844630 A>C
- Sequence
gcctaaaatagcctgctggagaat[A/C]agatatcacatgatacagagataa
- ASB for transcription factors
- MEF2D_HUMAN MITF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MEF2D_HUMAN | 2.40 | n/a | 3.00 | n/a | No Hit | |||
| MITF_HUMAN | 2.04 | -4.71 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Coronary, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood