rs539792747 chr16:23182616 C>G
- Sequence
ggcgttgtgaagtcgtggcccgct[C/G]cgggcggtctcaggtgcctggcgg
- ASB in cell types
- WA09 (embryonic stem cells)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.17 | 0.75 | 1.09 | 4.28 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
