rs539852902 chr8:105031722 T>G
- Sequence
tgcatttcacaatttccctattgt[T/G]aaacatttatgttgtctcttatct
- ASB in cell types
- MSC (mesenchymal stem cells)
- ASB for transcription factors
- CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPB_HUMAN | -0.19 | 3.40 | 1.50 | 3.59 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
