rs540353061 chr2:3652305 G>T
- Sequence
cttcctgtgcagagcctgggggcc[G/T]gtctgtctggtacctagagctcgg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 2.35 | -1.27 | 2.00 | |||
| HepG2 (hepatoblastoma) | 0.76 | 0.02 | 1.99 |
Items per page:
1 – 2 of 2