rs543316010 chr2:101725989 T>C
- Sequence
aaaagctgagtgttcttatgagtc[T/C]cctgcatatctagtgccccctgtc
- ASB in cell types
- GM19099 (female B-cells Lymphoblastoid Cell Lines) GM19193 (female B-cells Lymphoblastoid Cell Lines) ID00014 (lymphoblastoid cell, DiGeorge syndrome) foreskin keratinocyte
- ASB for transcription factors
- STAG1_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 2.15 | -1.79 | 3.36 | n/a | n/a | |||
| CTCF_HUMAN | 2.40 | -2.30 | 3.00 | n/a | No Hit |
Items per page:
1 – 2 of 2