rs543782324 chr2:72916200 A>G
- Sequence
gccggggcgccctgagcgctctcc[A/G]aaccacggctcccggcgctcaggc
- ASB in cell types
- SMMC-7721 (hepatocellular carcinoma)
- ASB for transcription factors
- PTEN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PTEN_HUMAN | -2.97 | 1.89 | 1.50 | n/a | n/a |
Items per page:
1 – 1 of 1