rs544959838 chr22:20804145 A>C
- Sequence
gggggcagcccacactcagtgatg[A/C]actgtgcacagcacgcactggtta
- ASB in cell types
- GM18486 (Lymphoblastoid Cell Lines) GM19239 (male B-cells lymphoblastoid cell line) GM19193 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- STAG1_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 1.17 | -0.48 | 1.08 | n/a | n/a | |||
| CTCF_HUMAN | 1.02 | -0.21 | 1.08 | n/a | No Hit |
Items per page:
1 – 2 of 2