rs546890158 chr14:73787076 G>T
- Sequence
ccccacgccggcgcccggtggcgg[G/T]agggggcgccgagcccgcggctta
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -2.10 | 2.08 | 1.00 | 2.67 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
