rs547184666 chr1:154558723 C>G
- Sequence
ccgggacaggcccccccctccgct[C/G]gctggcccccccagccgccggaag
- ASB in cell types
- HeLa (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa (cervical adenocarcinoma) | -0.20 | 1.34 | 1.80 |
Items per page:
1 – 1 of 1