rs548050388 chr11:68372945 C>G
- Sequence
ggctgtgtcagaatcactcagact[C/G]ttaagacacatccagagtccccag
- ASB in cell types
- adipose
- ASB for transcription factors
- PPARG_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PPARG_HUMAN | 2.26 | -4.75 | 2.75 | n/a | No Hit |
Items per page:
1 – 1 of 1