rs548390338 chr6:89433103 C>A
- Sequence
cgccgctgggaggcgctgcggcac[C/A]ggcgtaggagccgccggcaggggt
- ASB in cell types
- RH4 (alveolar rhabdomyosarcoma) pancreas
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| RH4 (alveolar rhabdomyosarcoma) | 2.69 | -4.93 | 2.00 | |||
| pancreas | 2.46 | -1.50 | 2.00 |
Items per page:
1 – 2 of 2