rs550913912 chr9:121320652 C>A
- Sequence
agagtgaaacctcgtctcaaaaaa[C/A]aaaaaaaaaaaaaagaaaaaaaga
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) 2588 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 1.42 | -0.73 | 1.00 | |||
| 2588 (Lymphoblastoid Cell Lines) | -1.74 | 2.05 | 1.00 |
Items per page:
1 – 2 of 2