rs555598158 chr4:183256893 C>G
- Sequence
gagtgtgatcctacagcccccccc[C/G]ccccccccccggctctgttcctgc
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) GM19193 (female B-cells Lymphoblastoid Cell Lines) GM02610 (Lymphoblastoid Cell Lines) GM18486 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -1.10 | 4.08 | 1.08 | n/a | No Hit | |||
| STAG1_HUMAN | -0.41 | 2.83 | 1.08 | n/a | n/a |
Items per page:
1 – 2 of 2