rs55634178 chr10:3172501 G>A
- Sequence
ggcaggcccggcccccagcccggg[G/A]catcgcccctgggagtaggaagga
- ASB in cell types
- iPSC (induced pluripotent stem cells) breast tumor
- ASB for transcription factors
- AP2A_HUMAN ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| AP2A_HUMAN | 3.19 | -2.99 | 1.00 | -4.96 | Concordant | |||
| ESR1_HUMAN | 2.89 | -5.22 | 2.00 | -2.55 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood