rs55636804 chr8:128041592 G>A
- Sequence
gtgtgtgtgtttgtgtgtgtttgc[G/A]tgtgtgtacatgtgtttggtgtgt
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.80 | 0.22 | 2.00 | |||
| HEK293 (embryonic kidney) | 0.76 | 0.52 | 1.23 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.42 | 1.05 | 1.39 |
Items per page:
1 – 3 of 3