rs55639033 chr18:51384530 T>C
- Sequence
tctgctgccacgatcttgaaattc[T/C]caataatttttgaacaagggaacc
- ASB in cell types
- GM18951 (B-cells Lymphoblastoid Cell Lines) GM19240 (B cells Lymphoblastoid Cell Lines) pancreas
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18951 (B-cells Lymphoblastoid Cell Lines) | 2.00 | -0.78 | 1.00 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | -0.79 | 1.02 | 1.00 | |||
| pancreas | -0.61 | 1.69 | 1.00 |
Items per page:
1 – 3 of 3