rs55649710 chr12:27220163 C>A
- Sequence
tgtagaattacagtatgagtcaat[C/A]tatctttttttcgtatttccatac
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.82 | 0.64 | 1.02 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellum, Brain_Frontal_Cortex_BA9, Esophagus_Mucosa, Esophagus_Muscularis, Stomach, Testis