rs55655706 chr16:87627109 G>C
- Sequence
ccgctgaatcagtgtctctgggcc[G/C]gggggcgaggccagtcattagttg
- ASB for transcription factors
- P63_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| P63_HUMAN | -2.42 | 1.62 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1