rs55685906 chr1:116168667 T>C
- Sequence
tagtattttctcctcgctttcaac[T/C]gaatggcggcattggtttcactat
- ASB in cell types
- glioblastoma cells K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| glioblastoma cells | -3.16 | 2.10 | 1.50 | |||
| K562 (myelogenous leukemia) | 0.60 | 0.88 | 1.10 |
Items per page:
1 – 2 of 2