rs55688203 chr7:28405783 C>T
- Sequence
ctcaggctgacctcttttcttctc[C/T]gtcatcagcttcctcctggatccc
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells) GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- PKNX1_HUMAN TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PKNX1_HUMAN | -2.41 | 2.81 | 1.00 | 4.37 | Concordant | |||
| TF65_HUMAN | 1.87 | n/a | 2.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
