rs55688306 chr3:194854909 G>A
- Sequence
ccttttcgctgtcacctggccagc[G/A]accttggctttagcatgcctctct
- ASB in cell types
- CWR22 (prostate carcinoma) MDA-MB-453 (breast adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CWR22 (prostate carcinoma) | -0.97 | 1.21 | 1.50 | |||
| MDA-MB-453 (breast adenocarcinoma) | -1.41 | 2.04 | 2.00 |
Items per page:
1 – 2 of 2