rs55698100 chr1:174258295 T>C
- Sequence
gaaaattcttaacacctctgaatc[T/C]tttttgttagactgggtctcactc
- ASB in cell types
- Peyer's patch right lobe of liver GBM39 (Human brain tumor)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Peyer's patch | -1.03 | 1.10 | 1.00 | |||
| right lobe of liver | -1.54 | 1.89 | 1.00 | |||
| GBM39 (Human brain tumor) | 1.39 | 0.35 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Substantia_nigra, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Testis, Thyroid, Whole_Blood