rs55700114 chr20:45088439 G>A
- Sequence
agtgttacaggccgaaatgatgag[G/A]gtcgtgatcaactccatatactac
- ASB in cell types
- PC3(bone mets prostate adenocarcinoma)
- ASB for transcription factors
- HIF1A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HIF1A_HUMAN | 1.23 | -0.33 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Lung, Minor_Salivary_Gland, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg