rs55700455 chr21:10711421 G>C
- Sequence
ccaattcactccactccacttcac[G/C]cctctccatttcattccattccat
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.07 | 1.32 | 3.30 | |||
| HepG2 (hepatoblastoma) | 0.51 | 1.42 | 4.07 |
Items per page:
1 – 2 of 2