rs55703044 chr17:75297611 A>T
- Sequence
actcaaacaccagtaaactaaaat[A/T]aaaaaaaaaaagaaagaaagaaag
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM19239 (male B-cells lymphoblastoid cell line) germinal center B-cells
- ASB for transcription factors
- MEF2B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MEF2B_HUMAN | 2.52 | -0.21 | 1.75 | -2.16 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
