rs55703699 chr7:7212819 A>G
- Sequence
acaagggctgggaggaatgttaca[A/G]agtacattcacaaggacagggaat
- ASB in cell types
- HepG2 (hepatoblastoma) ISt-1 (Gastric carcinoma)
- ASB for transcription factors
- TEAD3_HUMAN FOXA2_HUMAN HNF4A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TEAD3_HUMAN | 2.13 | -1.91 | 1.00 | n/a | No Hit | |||
| FOXA2_HUMAN | 1.71 | -2.78 | 1.50 | n/a | No Hit | |||
| HNF4A_HUMAN | 2.71 | -1.91 | 2.00 | -3.65 | Concordant |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Hippocampus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood