rs55706905 chr4:141711476 G>A
- Sequence
tagttgtgagaataaggacaatct[G/A]tttataatataaacaaattaaaaa
- ASB in cell types
- GM17942 (lymphoblastoid cell) glioblastoma cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM17942 (lymphoblastoid cell) | 2.63 | -2.29 | 1.00 | |||
| glioblastoma cells | 1.43 | -2.63 | 1.33 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Esophagus_Muscularis, Heart_Atrial_Appendage, Nerve_Tibial, Spleen