rs55713464 chr20:48621245 G>A
- Sequence
ctggaggagactcctggtaccccc[G/A]caaggcagccaggtgggcgtaaag
- ASB in cell types
- erythroid cells RCC 7860 (Renal cell carcinoma) VCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | 3.23 | n/a | 2.00 | |||
| RCC 7860 (Renal cell carcinoma) | -5.21 | 3.14 | 2.00 | |||
| VCaP (prostate carcinoma) | -0.66 | 1.08 | 1.00 |
Items per page:
1 – 3 of 3