rs55715293 chr2:714679 G>A
- Sequence
ttgtagagaagaaatgaggaccca[G/A]ggtgagaaattgttcaaggccaaa
- ASB in cell types
- NALM-6 (adult B acute lymphoblastic leukemia) GM10847 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| NALM-6 (adult B acute lymphoblastic leukemia) | 1.11 | -0.04 | 1.00 | |||
| GM10847 (female B-cells Lymphoblastoid Cell Lines) | 1.74 | -0.00 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Nerve_Tibial, Spleen, Testis, Thyroid