rs55721745 chr10:124384374 A>G
- Sequence
ctcaccagaatgaaaaacctgcca[A/G]gcctcggagggcaggatcccaagg
- ASB in cell types
- NALM-6 (adult B acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| NALM-6 (adult B acute lymphoblastic leukemia) | 1.64 | -0.82 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Esophagus_Gastroesophageal_Junction, Nerve_Tibial, Pancreas, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood