rs55724477 chr19:13152241 C>G
- Sequence
gcggcagccacgtgttcacgggga[C/G]tgtcgtgcgcgccgggttcgcagc
- ASB in cell types
- K562 (myelogenous leukemia) MDA-MB-231 (breast adenocarcinoma) HEK293 (embryonic kidney) HCT-116 (colon carcinoma)
- ASB for transcription factors
- BRD2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD2_HUMAN | 1.77 | 0.12 | 2.14 | n/a | n/a |
Items per page:
1 – 1 of 1