rs55725300 chr2:158963357 T>G
- Sequence
ctttagctacagctcactaagtag[T/G]caaatcaatctttactaagtagct
- ASB in cell types
- iPS-derived chondrocytes
- ASB for transcription factors
- RARA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RARA_HUMAN | 1.58 | 0.46 | 1.00 | -0.51 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
