rs55728265 chr15:38564760 C>T
- Sequence
gtagccccggcgcccgccagccct[C/T]gagcccggcgagcccgaccgaggt
- ASB in cell types
- MOLT-4 (Adult T acute lymphoblastic leukemia) foreskin keratinocyte T47D (invasive ductal carcinoma) RWPE1 (prostate epithelial cells)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.14 | 0.39 | 1.35 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_EBV-transformed_lymphocytes, Esophagus_Mucosa, Heart_Atrial_Appendage, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis