rs55731973 chr19:47113120 G>T
- Sequence
aatcaggaattgacacaaaatggc[G/T]gctcggcccgaaccagcctagagg
- ASB in cell types
- K562 (myelogenous leukemia) HCT-116 (colon carcinoma) SK-N-SH (neuroblastoma) tibial nerve
- ASB for transcription factors
- USF1_HUMAN TYY1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| USF1_HUMAN | 0.50 | 2.67 | 1.25 | n/a | No Hit | |||
| TYY1_HUMAN | 2.20 | 1.42 | 1.46 | -3.04 | Discordant |
Items per page:
1 – 2 of 2
Motif analysis
