rs55737170 chr10:25875638 G>T
- Sequence
gtgaaccctggagaaacacctcag[G/T]gtgagttggctatgcaggataaac
- ASB in cell types
- esophagus squamous epithelium T cells from peripheral blood
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| esophagus squamous epithelium | 1.92 | -1.61 | 1.00 | |||
| T cells from peripheral blood | 2.33 | -2.17 | 1.00 |
Items per page:
1 – 2 of 2