rs55744247 chr5:53482034 G>A
- Sequence
tgcctggtgcccggacgtgggcgc[G/A]gaggaaagcagccctcggagattt
- ASB in cell types
- macrophages spleen
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| macrophages | 1.38 | n/a | 2.50 | |||
| spleen | -1.58 | 1.91 | 1.00 |
Items per page:
1 – 2 of 2