rs55747905 chr7:87497783 T>C
- Sequence
aactgcaagggcagaggtctttca[T/C]ctcagtgtcggaagttccagctgg
- ASB in cell types
- liver
- ASB for transcription factors
- RXRA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RXRA_HUMAN | -3.11 | 3.42 | 1.00 | 4.33 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Nerve_Tibial, Ovary, Skin_Not_Sun_Exposed_Suprapubic, Testis