rs55758249 chr6:108598443 A>G
- Sequence
ctgagtgataaactgaactgaggc[A/G]accacaagcaggatacataaaaaa
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) MDM(monocyte derived macrophages)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.81 | 0.50 | 1.13 | |||
| MDM(monocyte derived macrophages) | 1.44 | n/a | 2.50 |
Items per page:
1 – 2 of 2