rs55760503 chr11:16820558 G>C
- Sequence
atcctcaaaacagaggtggtagcg[G/C]tggcagaaaccaggctggaggctt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.88 | 0.38 | 1.12 | |||
| MS-1 (Small cell lung carcinoma) | 0.44 | -0.27 | 1.00 |
Items per page:
1 – 2 of 2