rs55778567 chr1:4652928 C>T
- Sequence
cggcagggaaactgctgagtcacc[C/T]tgctgcctctcgggtcctctgacc
- ASB in cell types
- gastroesophageal sphincter GM02630 (Fanconi anemi) GM02255 (Lymphoblastoid Cell Lines) MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| gastroesophageal sphincter | 2.41 | -2.11 | 1.00 | |||
| GM02630 (Fanconi anemi) | 1.97 | 0.00 | 1.00 | |||
| GM02255 (Lymphoblastoid Cell Lines) | -0.44 | 0.89 | 1.00 | |||
| MS-1 (Small cell lung carcinoma) | -0.87 | 0.89 | 1.00 |
Items per page:
1 – 4 of 4